Retail, Cultivation, Processing, and Distribution Cannabis License Applications Open Now! Get Yours Today!
 

Constructing Plasmids with a Novel Ubiquitin Promoter For Use in the Transformation of Cannabis Sativa L.

Constructing Plasmids with a Novel Ubiquitin Promoter For Use in the Transformation of Cannabis Sativa L. 

By: Faith Ann Sparks

Have you ever wondered how scientists engineer the DNA they put into genetically modified plants? Today there are kits one can use to make the whole in-vitro process simple and quick. But at Fresh Alternative Farms, we want to communicate the science of what is happening in the lab so our clients can understand the technology and take on their own research with confidence! Tissue culture expert and novice gene jockey, Faith Ann Sparks, breaks it down in her capstone thesis project for her graduate degree at Cornell University titled, constructing plasmids with a novel ubiquitin promoter for use in the transformation of Cannabis sativa L. Faith used molecular biology to replace a universal gene element called a promoter with one found by Phylos that is specific to cannabis. In a nutshell, the techniques described in Faith’s capstone paper are fundamental to the science of genetic engineering and can be used to construct DNA with more complicated utility.

If you enjoy this content and want to learn more, schedule a consultation on our Calendly today!

https://calendly.com/freshalternativefarms/cannabis-licensing

 

Constructing Plasmids with a Novel Ubiquitin Promoter For Use in the Transformation of Cannabis Sativa L.

 

A Thesis

Presented to the Faculty of the Graduate School

of Cornell University

in Partial Fulfillment of the Requirements for the Degree of
Master of Professional Studies | Hemp Science

by
Faith Ann Sparks
December 2022

 

ABSTRACT

To date there has not been rigorous analysis of promoter efficacy in Cannabis sativa L. Promoter-driven transgene expression has the potential to greatly speed development of C. sativa cultivars with novel traits. Methods to genetically engineer C. sativa and regenerate transgenic plants have been recently described in multiple publications, however these methods utilized standard promoters to drive transgenes, rather than native C. sativa promoters. In this study a patented C. sativa UBIQUITIN gene promoter (CsUBQprom) was cloned into two different plasmids containing different reporter genes for the purpose of characterizing the pattern of expression driven by CsUBQprom in C. sativa. Using conventional enzyme digest and ligation methods, the SiM24 promoter was replaced with CsUBQprom in pSiM24-GFP and pSiM24-GUS to construct pFAH101 and pFAH112,

respectively. Research to develop a toolkit of native C. sativa promoters would facilitate further genetic engineering and genome editing studies and accelerate this approach to hemp

breeding efforts in the future.

 

BIOGRAPHICAL SKETCH

Faith Sparks graduated with a Bachelor of Science degree in Agronomy majoring in Horticulture from Michigan State University in May 2018.  She worked as a medicinal Cannabis grower for Pure Options from May 2018 to December 2018. Faith volunteered at a community outreach center from January 2019 to May 2019. In May 2019, she started as a Lab Technician in the Plant Transformation facility in the School of Integrative Plant Science at Cornell University.  She began pursuing the Master of Professional Studies degree in the employee degree program in August 2020.

 

This project is dedicated to my daughter, Hattie.

Embrace what drives you to discover new things. The world is vast and complex, and you are

strong and intelligent. There is everything you can explore.

 

ACKNOWLEDGMENTS

New York State Department of Agriculture and Markets

MM & TR Hatt

Laurence B. Smart

Christine D. Smart

Jacob A. Toth

Heather L. Grab

Brennan Hyden

Adam J. Bogdanove

Laura H. Gunn

Matthew R. Willmann

&

Everyone who helped along the way, especially

Eugene C. Sparks

 

 

TABLE OF CONTENTS

ABSTRACT……………………………………… ii

BIOGRAPHICAL SKETCH……………… iii

ACKNOWLEDGMENTS…………………… v

TABLE OF CONTENTS…………………… vi

LIST OF FIGURES…………………………. vii

LIST OF TABLES………………………….. viii

LIST OF ABBREVIATIONS…………….. ix

INTRODUCTION……………………………… 1

Purpose of study…………………… 1

Product of study…………………… 2

MATERIALS & METHODS………………. 3

Preparation of reporter gene plasmids……………………………… 3

DNA ligation……………………….. 5

Plasmid sequencing………………. 7

RESULTS…………………………………………. 8

Vectors and insert confirmation 8

Ligation…………………………….. 10

Sequencing of plasmids……….. 11

LITERATURE CITED…………………….. 13

 

 

LIST OF FIGURES

Figure 1. Map of pSiM24-eGFP showing restriction enzyme recognition sites, gene features,

and common sequencing primers (purple). ………………………………………………………………….. 3

Figure 2. Map of pSiM24-GUS showing restriction enzyme recognition sites, gene features,

and common sequencing primers (purple). ………………………………………………………………….. 4 Figure 3. Graphical representation of colony isolation following transformation. ……………… 6

Figure 4. Schematic representation of  workflow for bacterial colony isolation following

transformation………………………………………………………………………………………………………… 7

Figure 5. Image of 1% agarose gel with 1 kb ladder and EcoR I/Hind III restriction enzyme

digestion and CsUBQprom PCR product. ……………………………………………………………………. 8

Figure 6. Image of 1% agarose gel electrophoresis to resolve diagnostic restriction enzyme

digestion of pFAH101 and pFAH112. ………………………………………………………………………… 9 Figure 7. Map of pFAH101 showing gene features and CsUBQprom cloning sites. …………. 11 Figure 8. Map of pFAH112 showing gene features and CsUBQprom cloning sites. …………. 12

 

 

LIST OF TABLES

 Table 1. List of oligonucleotide primers used to sequence the constructed plasmids pFAH101 and pFAH112. ……………………………………………………………………………………………………….. 7

Table 2. Results from pFAH101 through pFAH106 bacterial transformation of DH5α cells of 7:1 insert to vector ligation reaction. ………………………………………………………………………… 10

 

 

LIST OF ABBREVIATIONS

CsUBQprom: Cannabis sativa ubiquitin promoter eGFP: Eukaryotic green fluorescent protein

GUS: β-glucuronidase

M24: A modified full-length transcript promoter in plants pDNA: Plasmid DNA

 

 

INTRODUCTION

 

Purpose of study

Due to waning momentum in the hemp industries by investors and farmers alike, it will become increasingly more important to reduce costs and speed outputs in hemp breeding programs. One way to contribute to a more efficient program is by elucidating potential genetic gains at a small scale through genetic engineering (do Livramento et al., 2022; Dong and Ronald, 2019). To date there have been multiple studies to genetically transform

Cannabis sativa L. (Feeney & Punja, 2003; Sorokin et al., 2020; Galan-Avila et al., 2021; Ahmed et al., 2021; Zhang et al., 2021).  However, these studies report low transformation efficiency, a failure to regenerate viable transgenic plants, and/or high rates of chimeric gene expression throughout the transformants. To improve these issues, genetic transformation and plant regeneration protocols should be optimized for the crop under investigation before they can be considered as a tool in an established cultivar development program. One way to optimize the efficiency of genetic transformation in a new crop species is to employ native promoters from the species being transformed to drive or inhibit expression of a desired gene

(do Livramento et al., 2022).

A promoter is a segment or region of DNA in which transcription of a gene is triggered. Promoters are an essential component of the process of expression because they control the binding of RNA polymerase to DNA at the gene locus. RNA polymerase transcribes DNA to mRNA which is ultimately processed and often translated into a functional protein or some other element in the transcriptome. Thus, the promoter region controls when and where in the organism your gene of interest is expressed. It has been common practice in the study of plant genomics to utilize plant-specific, species-specific, and even tissue-specific promoters to validate the expression of genes in plants (do Livramento et al., 2022). In C. sativa, there has not been sufficient investigation in such regulatory elements to date. Therefore, the purpose of this report is to initiate the intricate study of C. sativa genetics to advance the efficiency of C. sativa functional genomics studies in mind.

 

Product of study

The expected product of this study was to construct plasmids to be used in genetic transformation for the expressed purpose of developing new tools for the genetic engineering of C. sativa.

The author of this research understands the societal implications of resource mismanagement both in the industrial breeding and hobby breeding spaces surrounding C. sativa. The impetus behind building the plasmids described in this work stems from a desire to advance the rate of progress in the academic plant breeding programs as well as industrial plant breeding programs for this crop.

 

 

MATERIALS & METHODS

 

Preparation of reporter gene plasmids

Two vector plasmids were obtained from Addgene (https://www.addgene.org/) due to the presence of multiple cloning sites adjacent to useful reporter genes, pSiM24-eGFP (Figure 1) and pSiM24-GUS (Figure 2) (Sahoo et al., 2014). The pSiM24-eGFP plasmid contains the eukaryotic green fluorescent protein (eGFP) driven by the M24 promoter, while pSiM24-GUS contains the β-glucuronidase (GUS) gene driven by the same M24 promoter. Both pSiM24eGFP and pSiM24-GUS were digested with EcoR I and Hind III to excise the M24 promoter from the plasmids. The digestion reactions were mixed with SDS-free dye and loaded onto a 1% agarose gel then resolved by gel electrophoresis using 100V of electrical current for a

Figure 1. Map of pSiM24-eGFP showing restriction enzyme recognition sites, gene features, and common sequencing primers (purple). FreshAF - Tissue Culture
Figure 1. Map of pSiM24-eGFP showing restriction enzyme recognition sites, gene features, and common sequencing primers (purple). FreshAF – Tissue Culture

Figure 1. Map of pSiM24-eGFP showing restriction enzyme recognition sites, gene features, and common sequencing primers (purple).

Figure 2. Map of pSiM24-GUS GUS showing restriction enzyme recognition sites, gene features, and common sequencing primers (purple).
Figure 2. Map of pSiM24-GUS GUS showing restriction enzyme recognition sites, gene features, and common sequencing primers (purple).

Figure 2. Map of pSiM24-GUS GUS showing restriction enzyme recognition sites, gene features, and common sequencing primers (purple).

total of 45 minutes. The vectors were extracted from the agarose gels using the Monarch DNA gel extraction kit T1020S (New England Biolabs, Ipswich, MA), and recovered DNA was precipitated at -20C for 72 hours. The vector DNA was then dephosphorylated with recombinant shrimp alkaline phosphatase from New England Biolabs M0371S to remove the phosphate groups at the digested sites and inhibit recircularization of the vector to itself in the downstream application.

In a different workflow a pUC19 plasmid containing a cloned fragment of the C. sativa ubiquitin promoter (CsUBQprom) sequence was generously shared from Phylos Bioscience (Portland, OR).  DNA was amplified by simple overhang PCR from this plasmid using standard Taq Polymerase (M0273S from New England Biolabs), primers, 5’CCGAATTCAAAGTCTTGCAGTGTAATTACGGGT-3’ and 5’-GCAAGCTTCTAAAATTACACAATTAAACCAAAATC-3’ obtained from IDT (Coralville, IA), and deoxynucleotide solution mix (N0447S from New England Biolabs) to clone the patented CsUBQprom (1191 bp). The cloned promoter was then treated as an insert for the remainder of the project. Enzyme digestion was employed and the overhang regions of the CsUBQprom fragment were digested with EcoR I and Hind III to create sticky ends. To remove the deactivated enzymes and residual oligonucleotides that were digested off both ends of the CsUBQprom fragments gel purification with Monarch DNA gel extraction kit was used. Coincidentally, this step also isolated the desired sticky ended fragments of the insert CsUBQprom. Standard DNA precipitation was performed on the recovered sticky ended fragments to obtain the 1191 bp fragment of DNA to be used as the insert for downstream applications.

 

DNA ligation

DNA ligation was conducted using T4 DNA ligase according to the manufacturer (M0202S from New England Biolabs) following the protocol supplied with the T4 DNA ligase reagent for plasmid ligation at a 7:1 insert to vector ratio. Genetic transformation of competent DH5α E. coli cells (EC0112 from ThermoFisher Scientific) was conducted following the publicly accessible Addgene protocol (https://www.addgene.org/protocols/bacterial-transformation/; last accessed 20 Nov 2022) to obtain two new plasmids containing the CsUBQprom instead of the original M24 promoter driving the reporter genes eGFP or GUS. Immediately following ligation, the reactions were used as the plasmid component in a heat shock bacterial transformation of E. coli. The plasmid reactions that resulted in successful bacterial selection originated from ligation reaction of 7:1 insert to vector ratio.

 

Bacterial colony selection

Antibiotic resistant colonies were identified, streaked to single colonies over the course of time as represented in Figures 3 and 4, and plasmid DNA (pDNA) was extracted according to the manufacturer’s protocol (D4209 from Zymo Research). Diagnostic restriction enzyme digestion was performed using Nde I, BamH I, and Sac I (R0111S, M02223S, and R3156S respectively from New England Biolabs) in a standard 37C reaction for 2 hours followed by a 20-minute deactivation period at 65C. The products were mixed with SDS-free loading dye and completely loaded onto a 1% agarose gel, resolved by electrophoresis 100 V for a total of 45 minutes, and imaged with a Bio-Rad geldoc with Image Lab software (1708195 from BioRad).  

Figure 3. Graphical representation of colony isolation following transformation. FreshAF - Tissue Culture
Figure 3. Graphical representation of colony isolation following transformation.

Figure 3. Graphical representation of colony isolation following transformation.

Figure 4. Schematic representation of workflow for bacterial colony isolation. FreshAF - Tissue Culture
Figure 4. Schematic representation of workflow for bacterial colony isolation.

Figure 4. Schematic representation of workflow for bacterial colony isolation.

 

Plasmid sequencing

Plasmid sequences were confirmed with Sanger sequencing conducted at the Cornell

Biotechnology Resource Center (Ithaca, NY) using primers listed in Table 1. Both plasmids were sequenced using the primers LBFWD, CsUBQFWD, CsUBQintFWD, and Seq8 (eGFP) or Seq9 (GUS). E. coli cultures corresponding to the positive plasmids were grown in overnight cultures in liquid LB media supplemented with 100 mg L-1 ampicillin and stored in sterile 50% glycerol at -80°C.  pDNA was extracted from both cultures of E.coli and mixed individually with the primers described above (Table 1), resulting in 14 unique sequences that spanned the junction points between the CsUBQprom insert and the pSiM24 vectors. Sequence alignments were analyzed using SnapGene 6.1.1 (GSL Biotech LLC, San Diego, CA).

Table 1. List of oligonucleotide primers used to sequence the constructed plasmids pFAH101 and pFAH112.

Primer NameSequence (5’ to 3’)Position/

Direction

Plasmid target
LBFWDGATACAGGCAGCCCATCAGTCC1 – FWD101 & 112
CsUBQFWDGGGTTGAAAAATTACAAAAT2 – FWD101 & 112
CsUBQintFWDCCGAGTCTAAGTTTGGGTG3 – FWD101 & 112
CsUBQintREVGCAGATGAACAAAAAGTACATTAC4 – REV101 & 112
CsUBQREVGCTTCTAAAATTACACAATT5 – REV101 & 112
Seq8CCGTCCAGCTCGACCAGGATG6 – REV101
Seq9GGCCGTCGAGTTTTTTGATTTCACG6 – REV112

 

RESULTS

 

Vectors and insert confirmation

Bands were observed in both the pSiM24-eGFP and pSiM24-GUS plasmid EcoR I/Hind III digestions at 635 bp representing the excised M24 promoter (Figure 5). Additionally, bands were observed at 7.1 kb and 8.2 kb size representing the pSiM24-eGFP and pSiM24-GUS vectors. The sizes of these bands indicated that the restriction enzymes EcoR I and Hind III cut at their respective recognition sites and the pDNA resolved by the agarose gel at the 7.1 kb and 8.2 kb sizes represented the molecular products to be used in the upstream ligation reactions. The M24 promoter fragment encapsulated in the agarose gel at the 635 bp mark was discarded. The PCR product of the cloned CsUBQprom, digested with EcoR I and Hind III was observed in agarose gel at approximately the 1.2 kb mark indicating successful reactions in both the amplification of the insert as well as the generation of sticky ends.

Figure 5. Image of 1% agarose gel with 1 kb ladder and EcoR I/Hind III restriction enzyme digestion and CsUBQprom PCR product. A. pSiM24-eGFP digested with EcoR I/Hind III with vector at 7.1 kb and M24prom at 635 bp; B. pSiM24-GUS digested with EcoR I/Hind III with vector at 8.2 kb and M24prom at 635 bp; C. 1.2 kb CsUBQprom PCR product; D. Map of CsUBQprom PCR product. FreshAF - Tissue Culture
Figure 5. Image of 1% agarose gel with 1 kb ladder and EcoR I/Hind III restriction enzyme digestion and CsUBQprom PCR product.
A. pSiM24-eGFP digested with EcoR I/Hind III with vector at 7.1 kb and M24prom at 635 bp; B. pSiM24-GUS digested with EcoR I/Hind III with vector at 8.2 kb and M24prom at 635 bp; C. 1.2 kb CsUBQprom PCR product; D. Map of CsUBQprom PCR product.

Figure 5. Image of 1% agarose gel with 1 kb ladder and EcoR I/Hind III restriction enzyme digestion and CsUBQprom PCR product.

(A) pSiM24-eGFP digested with EcoR I/Hind III with vector at 7.1 kb and M24prom at 635 bp;  (B) pSiM24-GUS digested with EcoR I/Hind III with vector at 8.2 kb and M24prom at 635 bp;  (C) 1.2 kb CsUBQprom PCR product; D. Map of CsUBQprom PCR product.

 

To confirm successful ligation of insert to vector in the plasmids, diagnostic Nde I/BamH I/Sac I restriction enzyme digestion reactions were conducted and separated by agarose gel electrophoresis, and bands of the predicted sizes were resolved according to the position of the restriction enzyme sites. For pFAH101 bands were present at 6.5 kb, 1.1 kb and 735 bp as seen in Figure 6 lane 2. This contrasts with the bands resolved for pSiM24-eGFP (Figure 6, lane 3) in which bands were present at 7 kb and 736 bp indicating an absence of the Nde I site unique to the CsUBQprom insert. Similarly, for pFAH112 bands were present at 6.5 kb, 1.8 kb, and 1.1 kb (Figure 6, lane 4) and the control pSIM24-GUS only had bands at 7 kb and 1.8 kb (Figure 6, lane 5) also confirming the successful addition of the CsUBQprom in the new plasmid that was not present in the original plasmid.

 

Figure 6. Image of 1% agarose gel electrophoresis to resolve diagnostic restriction enzyme digestion of pFAH101 and pFAH112Lane 1: 1 kb+ ladder Lane 2: pFAH101 digested with NDE I/BAMH I / Sac I Lane 3: pSiM24-ep digested with NDE I/BAMH I/Sac I Lane 4: pFAH112 digested with Nde I/BamH I/Sac I Lane 5:  pSiM24-GUS digested with Nde I/BamH I/Sac I Lane 6: pUC19-CsUBQprom (Phylos) digested with Nde I Lane 7: Empty Well Lane 8: 1kb+ ladder
Figure 6. Image of 1% agarose gel electrophoresis to resolve diagnostic restriction enzyme digestion of pFAH101 and pFAH112
Lane 1: 1 kb+ ladder
Lane 2: pFAH101 digested with NDE I/BAMH I / Sac I
Lane 3: pSiM24-ep digested with NDE I/BAMH I/Sac I
Lane 4: pFAH112 digested with Nde I/BamH I/Sac I
Lane 5:  pSiM24-GUS digested with Nde I/BamH I/Sac I
Lane 6: pUC19-CsUBQprom (Phylos) digested with Nde I
Lane 7: Empty Well
Lane 8: 1kb+ ladder

 

Ligation

The products of the ligation reaction were used to perform E. coli transformations. The first transformation consisted of pDNA from the ligation reaction that were conducted using a 7:1 ratio of insert to vector. The number of colonies surviving on selection medium per 25 cm plate were counted and the summarized data can be found in Table 3.

Table 2. Results from pFAH101 through pFAH106 bacterial transformation of DH5α cells of 7:1 insert to vector ligation reaction.
Table 2. Results from pFAH101 through pFAH106 bacterial transformation of DH5α cells of 7:1 insert to vector ligation reaction.

Table 2. Results from pFAH101 through pFAH106 bacterial transformation of DH5α cells of 7:1 insert to vector ligation reaction.

 

Sequencing of plasmids

 

Plasmid DNA isolated from antibiotic resistant colonies that were streaked to isolation was sequenced using the primers in Table 1 (see also Figs. 7 and 8).  Sequence analysis confirmed the proper insertion of CsUBQprom into the EcoR I and Hind III sites of pSiM24-eGFP to produce pFAH101 (Figure 7).  Likewise, sequence analysis confirmed the proper insertion of CsUBQprom into the EcoR I and Hind III sites of pSiM24-GUS to produce pFAH112 (Figure 8).

Figure 7. Map of pFAH101 showing gene features and CsUBQprom cloning sites.
Figure 7. Map of pFAH101 showing gene features and CsUBQprom cloning sites.
Figure 8. Map of pFAH112 showing gene features and CsUBQprom cloning sites.

Figure 8. Map of pFAH112 showing gene features and CsUBQprom cloning sites.

 

 

LITERATURE CITED

Alberto Galan-Avila PG, Mily Ron, Jaime Prohens, Francisco Javier Herraiz (2021) A novel and rapid method for Agrobacterium-mediated production of stably transformed Cannabis sativa L. plants. Industrial Crops and Products 170, 113691

Aleksei Sorokin NSY, Daniel Gaudet & Igor Kovalchuk (2020) Transient expression of the β-glucuronidase gene in Cannabis sativa varieties. Plant Signaling & Behavior 15:8, 1780037.

Dipak Kumar Sahoo, Nrisingha Dey, Indu Bhushan Maiti (2014) pSiM24 is a novel versatile gene expression vector for transient assays as well as stable expression of foreign genes in plants. PLOS One 9: 0098988.

Kalynka Gabriella do Livramento NCF, Luciene de Oliveira Ribeiro Trindade, Luiz

Gustavo da Silva Teixeira, Luciano Vilela Paiva, Patrícia do Nascimento Bordallo, Leandro Eugenio Cardamone Diniz (2022) Gene expression analysis associated with tissue-specific promoters in Musa spp. Acta Scientarium 44: e55893.

Oliver Xiaoou Dong and Pamela C Ronald (2019) Genetic engineering for disease resistance in plants: Recent progress and future perspectives. Plant Physiology 180: 26-38

Feeney M and Punja ZK (2003) Tissue culture and Agrobacterium-mediated transformation of hemp (Cannabis sativa L.). In Vitro Cellular & Developmental Biology – Plant. 39: 578-585.

Sajjad Ahmed XG, Md. Asraful Jahan, Maxwell Adams, Nianqiang Wu, Nik Kovinich (2021) Nanoparticle-based genetic transformation of Cannabis sativa. Journal of Biotechnology 326: 48-51.

Xiaoyu Zhang GX, Chaohua Cheng, Lei Lei, Jian Sun, Ying Xu, Canhui Deng, Zhigang, Dai, Zemao Yang, Xiaojun Chen, Chan Liu, Qing Tang, and Jianguang Su, (2021) Establishment of an Agrobacterium-mediated genetic transformation and CRISPR/Cas9-mediated targeted mutagenesis in hemp (Cannabis sativa L.). Plant Biotechnology Journal 19(10): 1979-1987.

 

 

 

Leave a Reply

Your email address will not be published. Required fields are marked *